viernes, 27 de enero de 2012

Vuela que te vuela



No sé si a vosotras os pasa lo mismo, pero a mi después de hacer un trabajo grande me apetece ponerme a hacer cosas pequeñas y máxime si el trabajo que has hecho es a máquina. 

Pues eso es lo que me pasó a mi después de montar mi Bed Runner, me apetecía  hacer un pequeño trabajo y si era mezclado con stitchery mucho mejor.

Todo empezó porque me regalaron en Diciembre  una lámpara de sal, hacía mucho tiempo que quería tener una y cuando la recibí y pensé donde la colocaría, me dije que esa bonita lámpara se merecía tener un tapete precioso. En ese momento no podía meterme con él, así que todo lo que veía por ahí tomaba nota de ello y mezclando ideas se me ocurrió al final la composición que he hecho. 



Escogí las telas que iba a utilizar, unas bonitas telas japonesas y de colores suaves  que tengo guardadas hace tiempo, con unas de lino que le venían muy bien. Preparé el libro y las reglas  que me han traído los RR.RR. y cuando lo tenía todo dispuesto para empezar a copiar el primer dibujo que más o menos tenía pensado hacer, mezclando algo que había visto en la red y otras cosas con mis libros de bordados de Yoko Saito, me dije voy a hacer algunas visitas a mis chicas. Entre todas las visitas que hice me pase por casa de Eva  y allí vi el dibujo que al final he bordado. Se trata de uno de los bloques de un bonito Quilt que está haciendo, se llama Butterflay.....



Unas preciosas mariposas


Florecillas, por aquí

y por allá. 

Los  hilos que he utilizado han sido de algodón del nº 12. Y la tela ha sido la beige lisa de todas las que había elegido. 

Ya tenía mi bordado hecho, ahora con el resto de las telas iba a hacer unos vuelos de la oca. Parecía que éste tapete tendría que ser de altura, se habían unido las mariposas del stichery con los vuelos de la oca del patch. 



12 pequeños vuelos de la oca de 1" x 2 " irían en los lados del bordado, y conjuntando todas las telas, quedaron así de bonitos.

Ahora sólo quedaba montar el pequeño top. Las medidas totales han sido de 12" x 14" . Habéis visto sigo trabajando en pulgadas jejeje.



 Empecé por acolchar con hilo de Gutenberg  encerado, las flores, haciendo un pequeño eco a todo alrededor


Seguí por las mariposas, y después de hacer el primer eco, continué haciendo más, pero no me gustaba, quitaba importancia al bordado, así que lo deshice y dejé sólo el primer eco para realzar precisamente el precioso stitchery.


La primera idea era acolchar los vuelos de la oca a 1/4", pero tal y como estaba quedando el trabajo, también desistí de ello. Opté por hacer éste dibujo a los extremos de la tela central en hilo de algodón naranja, uno de los que había utilizado para las flores.

Y me diréis, pero bueno nos vas a enseñar el trabajo entero, o que?..... es verdad, me he puesto a escribir y poner fotos y no me he dado cuenta de ello.

Aquí está.


Verdad que ha quedado de lo más coqueto y tierno.

Seguro que os habréis dado cuenta que no he puesto bies, ha sido otra innovación que he hecho con respecto a lo que estamos acostumbradas a ver.

El sándwich que he hecho para coser ha sido, guata, top, trasera (el derecho de la trasera debe de mirarse con el derecho del top). Cosido todo a máquina dejando una abertura para darle la vuelta.

Supongo que a vosotras también os pasará que por pequeño que sea un trabajo, estáis un par de días mirándolo como una tonta jejejeje....


43 comentarios:

  1. Monisimoooo, de verdad te ha quedado muy muy fino, las telas son muy elegantes ¡¡¡ te ha quedado perfecto¡¡¡¡ Un beso

    ResponderEliminar
  2. Te ha quedado genial... ¡y encima diseñado por ti! Como dices, es un trabajo "de altura".
    Un beso fuerte
    Elena

    ResponderEliminar
  3. Te quedo precioso y los colores muy bien combinados.
    Un saludo
    Miri

    ResponderEliminar
  4. ¡Pues a mi como siempre me dejais asombrada de la facilidad que teneis para hacer cosas tan bonitas! me encanta. Un abrazo

    ResponderEliminar
  5. Puedes imaginarte cuanto me gusta, verdad??, jeje. Esta ideal Isa. Felicidades!!

    ResponderEliminar
  6. Te quedó precioso Isabel felicitaciones!!!! te dejo un besito y yo tambien me quedo mirando como una tonta largo rato cuando termino algo jajjajaj
    hasta prontito ♥♥

    ResponderEliminar
  7. Un lindo diseño en unos tonos muy adecuados, queda precioso, me gusta mucho Isabel.
    Besicos, Maribel.

    ResponderEliminar
  8. Como una tonta me he quedado yo .
    Está super fino , elgante .
    Me encanta !!
    Un beso y buen fin de semana

    ResponderEliminar
  9. Que original! Y sin bies!! Y es que a veces lo sencillo es lo mas coqueto.
    Un Abrazo

    ResponderEliminar
  10. precioso, me encantó, sobre todo la mezcla de bordado con patchwork, los colores....

    me parece preciosa la combinación

    besosooss

    ResponderEliminar
  11. te ha quedado super original, me gusta mucho!!! eres una artista!!!

    ResponderEliminar
  12. Que trabajo tan delicado, es una monada!!!!!

    ResponderEliminar
  13. Pero que bonito te ha quedado!!!! Me gusta mucho mucho mucho, felicidades, es super fino y elegante. Besos.

    ResponderEliminar
  14. Es para mirarlo y mirarlo Isabel...tan lindo!! cada cosita y detalle que le has puesto le ha dado ese toque especial tuyo...Precioso!!..
    Besitos y feliz fin de semana!

    ResponderEliminar
  15. Muy bonito el diseño ,un resultado perfecto. Besinos

    ResponderEliminar
  16. Quieres que te diga lo que pienso?
    Que me encanta!!! Está precioso.
    Felicidades.
    Un saludo.

    ResponderEliminar
  17. Holaaaaaaaa Isabel ...ains una lámparita de sal ... son unas gozada...invitan a relajarse ...a ensoñar ... meditar .. incluso a poner música y disfrutar .... a mi me encantan ... y el tapete que le hiciste está divino ... me encanta sin bies ... y eso tonos lo hacen más cálido .. como siempre me ha gustado mucho venir a verte y te deseo un feliz fin de semana y besotes sss sss

    ResponderEliminar
  18. Precioso, Isabel.
    Me encanta el resultado.
    Reconozco que el vuelo de la oca me pierde, así que cualquier trabajo que tenga vuelo de la oca tiene el éxito casi asegurado para mí.
    Y los tonos de las telitas son de lo más acertados.
    Y sí, a mí también me pasa que cuando termino algo me paso ratos contemplándolo cual niño recién nacido.
    Un enorme abrazo cargado de energía positiva

    ResponderEliminar
  19. Muy tierno y dulce, un encanto.
    Un beso.

    ResponderEliminar
  20. Isabel, cómo te lo has currao!!!!!! te quedó divino el tapete. Único y diseñado por ti, esto si que es arte!!!!! el bordado me encanta....Un bseote mi niña

    ResponderEliminar
  21. Es monísimo. Y los colores tan suaves hacen que realmente como dices sea un trabajo muy delicado. El bordado de las flores es lo que más me gusta.
    Un abrazo,

    ResponderEliminar
  22. ¡¡Una preciosidad!!
    Siempre das un sello a tus labores, los colores de las telas y los diseños elegantes dicen mucho de tu buen gusto, te felicito.
    Saludos

    ResponderEliminar
  23. Que bonitooooo!! me ecantan las telitas y los dibujitos, ha quedado de lujo!!

    besillos

    ResponderEliminar
  24. Tiene muy buena pinta pero me he quedado sin ver el resultado final!!! No se cargan todas las fotos no sé que pasará!

    Si es verdad que despues de los grandes trabajos a maquina apetecen proyectos más "mimosos" a mano.

    Un besazo

    ResponderEliminar
  25. me encanta el lino y los bordados,nos hemos puesto de acuerdo,yo tambien estoy haciendo cosas pequeñas,tengo un libro que me traje,cuando estuve en Alsacia,Frances que tiene unos bordados preciosos de ese estilo,
    precioso,felicidades besos

    ResponderEliminar
  26. Hola Isa, soy Beatriz. Me ha encantado el tapete, es precioso. Disfrata la lámpara y muchas gracias por todo.

    ResponderEliminar
  27. Hola amiga!!!
    Te quedó genial!
    Felicitaciones!!!
    Un fuerte abrazo desde Venezuela!!!

    ResponderEliminar
  28. GGGUUUUUAAAAAAUUUUUUU!!!!!


    Un GRAN trabajo, si señora!!!!

    ResponderEliminar
  29. Me gusta un montón Isabel!!!! El vuelo de la oca es uno de mis bloques preferidos y queda perfecto como marco del stitchery.
    A mi tampoco me gusta que el acolchado sea el protagonista en una colcha y en tu tapete es un complemento perfecto.
    Felicidades guapa
    Un beso.

    ResponderEliminar
  30. Super lindo, felicidades...

    Un abrazo desde COSTA RICA.

    ResponderEliminar
  31. Super lindo, felicidades...

    Un abrazo desde COSTA RICA.

    ResponderEliminar
  32. Isabel
    Que bellos bordados!!!
    Un hermoso trabajo!!!
    Besitos!!!

    ResponderEliminar
  33. Que bonito !!! ha quedado muy delicado y sencillo. Precioso !!!!
    Besos

    ResponderEliminar
  34. Te ha quedado muy bonito. Como siempre tienes razón. Siempre que termino un trabajo me encanta mirarlo, si es posible a solas. Yo últimamente no consigo variar de trabajo grande a pequeño, solo hago "pequeños". Algún dia...
    Besos.

    ResponderEliminar
  35. Precioso Isa, queda finísimo!!!..., me gusta lo de no poner bies, yo lo he hecho en el quilt de corazones y me encanta el efecto...

    Un besote.

    ResponderEliminar
  36. Isabel, te ha quedado preciosooo !!

    No me extraña que te lo mires !!

    Un besito guapi !

    ResponderEliminar
  37. Bueno ya sabes mi opinión , QUE PASADA un beso
    Ahora estoy un poco desconectada a ver si no estoy tan liada y te visito un poco mas

    ResponderEliminar
  38. Muy bonito! Tu lámpara de sal lucirá genial!
    Besos.

    ResponderEliminar
  39. pues si niña, me ha gustado el blog, asì que por aqui me quedo
    por si te apetece darte una vuelta por el mio
    un saludo
    http://guedi-conmismanitas.blogspot.com/

    ResponderEliminar
  40. Pues es que te ha quedado de lujo! me encantan los bordaditos, yo también me encanghé al redwork :)))) Y además con ese bordado se queda muy dulce y luce mucho. el acolchado como siempre muy acertado :) y a mi me pasa como a ti, necesito "descansar" con trabajos pequeños después de uno grandote :)))) mi más sincera enhorabuena, te ha quedado muy muy bonito.

    pd. a mi me encanta también el vuelo de la oca :))))

    ResponderEliminar

!!!!Gracias por perder un ratito de tu tiempo y dejarme tus comentarios!!!!.